MAU VE SO TG

  -  
When a genome alignment is created, Mauve sầu creates several output files containing data related to the alignment. Two of these files, the .mauve sầu and .alignment files actually contain the alignment in two different formats. The other files contain auxiliary information such as the genome phylogenetic guide tree that was used for alignment, an identity matrix for the genomes, the location of backbone – regions conserved aý muốn all genomes, & the locations of islands – regions where one or a subset of the genomes has a unique sequence element.

Bạn đang xem: Mau ve so tg

The following sections describe the information contained by each of these files & their associated file formats.

The .alignment file và the XMFA tệp tin format

The .alignment file contains the complete genome alignment generated by Mauve sầu in the eXtended Multi-FastA (XMFA) tệp tin format. This standard tệp tin format is also used by other genome alignment systems that align sequences with rearrangements. The XMFA tệp tin format supports the storage of several collinear sub-alignments, each separated with an = sign, that constitute a single genome alignment. Each sub-alignment consists of one FastA format sequence entry per genome where the entry’s defline gives the strvà (orientation) and location in the genome of the sequence in the alignment.

The general structure of the tệp tin format as described by its author (Michael Brudno) is as follows:

>seq_num:start1-end1 ± comments (sequence name, etc.)AC-TG-NAC--TGAC-TG-NACTGTG...> seq_num:startN-endN ± comments (sequence name, etc.)AC-TG-NAC--TGAC-TG-NACTGTG...= comments, và optional field-value pairs, i.e. score=12345> seq_num:start1-end1 ± comments (sequence name, etc.)AC-TG-NAC--TGAC-TG-NACTGTG...> seq_num:startN-endN ± comments (sequence name, etc.)AC-TG-NAC--TGAC-TG-NACTGTG...= comments, & optional field-value pairs, i.e. score=12345

Non-standard XMFA formatting used by the Mauve GUI

The Java-based Mauve alignment viewer requires some non-standard formatting of the XMFA tệp tin in order to display it. Most importantly, the Mauve sầu viewer requires that every nucleotide of the input đầu vào genome sequences be recorded exactly once in the XMFA tệp tin. Thus, nucleotides in one genome can not khổng lồ multiple sites in a second genome. For segments of a genome that did not align và were outside LCBs, these segments most be given as ungapped singleton entries in the XMFA:

> seq_num:startN-endN ± commentsACTCAGGTTATCG...=A second non-standard formatting requirement is that the first LCB entry in the XMFA list all đầu vào genome sequences, even if they did not align in that LCB. Genomes that have no sequence in that LCB are given using 0-0 as the coordinate range. For example, in an alignment of four genomes where only two were aligned in the first LCB, the initial LCB might look like:

> 1:0-0 +>2:1-377 +ACGA---TAAAATTCCC...>3:1-422 - ACTACCCTACAATTGGC...>4:0-0 + =

The Mauve sầu alignment tệp tin format

The .mauve or .mln tệp tin also contains a representation of the genome alignment. Instead of including every aligned nucleotide as in the XMFA format, the Mauve sầu alignment format stores the coordinates of large exactly matching regions khổng lồ save space. For similar genomes the Mauve alignment format saves a significant amount of disk space over the XMFA format.

The mauve alignment format begins with a single line stating the revision of the file format, followed by several lines describing the sequences that were aligned. Using the alignment of three Salmonella genomes as an example:

FormatVersion 4SequenceCount 3Sequence0File D:S_typhi.fasSequence0Length 4809037Sequence1File D:S_typhi2.fasSequence1Length 4791961Sequence2File D:S_typhimurium.fasSequence2Length 4857432IntervalCount 69Currently Mauve uses version 4 of its alignment file format. The next line contains the token SequenceCount which is used khổng lồ specify the number of sequences aligned. Two lines are then given for each sequence, the first specifying the location of the original sequence file và the second specifying the sequence length in nucleotides. The final line contains the token IntervalCount which specifies the number of locally collinear blocks that were found aước ao the aligned genomes.

The remainder of the tệp tin contains a number of Interval definitions, each of which specifies an LCB– one collinear region of aligned sequence. Together, these LCBs biến hóa a complete genome alignment with rearrangements. Here is an example interval definition:

Interval 3153 292618 -2687311 294793GappedAlignment7 292771 -2687304 294946GCCTGCGGCCTGCGCCATGTC53 292778 -2687251 294953GappedAlignment1 292831 -2687250 295006AAG127 292832 -2687123 295007Each LCB begins with an Interval token specifying the relative sầu position of the LCB within the first genome aligned (the reference genome). Subsequent lines specify the actual alignment. When constructing an alignment, Mauve sầu chooses a set of multi-MUMs (exactly matching regions present in each genome aligned) khổng lồ anchor its alignment with. Each Interval definition records the position of these multi-MUM anchors in addition to lớn alignments of the regions between anchors that were calculated using Clustal-W. In the example above sầu, the line 153 292618 -2687311 294793 records a multi-MUM of length 153, with a left-kết thúc at 292,618 in S_typhi, on the opposite strvà at position 2,687,311 in S_typhi2, và at 294,793 in S_typhimurium.

The next 5 lines in the example above sầu give an alignment of inexactly matching sequence generated by ClustalW. The token ClustalResult indicates that the following lines belong khổng lồ such an alignment. The next line gives the total length of the (possibly gapped) alignment & the left-kết thúc of the Clustal alignment in each genome. Finally, the next three lines (one per sequence aligned) record the actual alignment.

Each Interval records one or more of the multi-MUM and Clustal alignment entries which, when strung together, can specify a complete alignment over the region spanned by the LCB.

Xem thêm: Chùm Thơ Cho Con Trai, Con Gái Yêu Của Cha Mẹ Hay ❤️️ Ý Nghĩa

The islands file

The .islands tệp tin contains a tab-delimited text listing of genomic islands found in the alignment. Each islvà represents a region of the alignment where one or more genomes have a sequence element that one or more others laông xã. In the current Mauve sầu implementation, an island is defined by the genome coordinates of one sequence where another genome contains a gap of length n or longer in that part of the alignment. The length of gaps that constitute islands can be phối with the Minimum Isl& Size field of the Align sequences dialog box. For example, if n was defined as 5 for the following alignment:

Genome 0: ACACGTTCGCTTCGAAAGenome 1: ACAC------TTCGAA-Genome 2: ATACGATCGCTTCGTAAWe would say that genomes 0 & 2 have sầu an island at positions 5 though 10. Each line of the .islands tệp tin records a single islvà in the form: GenomeA # leftA rightA GenomeB # leftB rightB. So in the .islands file, our example islands would be recorded as:

0 4 11 1 4 51 4 5 2 4 11The first line records that in Genome #0 nucleotides 4 through 11 align with nucleotides 4 though 5 in Genome #1. Similarly, the second line records that nucleotides 4 và 5 of Genome #1 align with nucleotides 4 through 11 of Genome #2. In both cases the island length is 6 & can be calculated as absolute((rightA - leftA) - (rightB - leftB)). chú ý that negative sầu left & right values indicate the inverse orientation (the opposite strand).

The original Mauve sầu backbone file

The .backbone tệp tin records regions of the alignment where sequence is conserved among mỏi all of the genomes being aligned. The current Mauve implementation defines a conserved region as an area of the alignment at least x nucleotides long that contains no gaps as long or longer than y nucleotides. When using the Align sequences window to persize an alignment, the values of x and y are fixed to lớn the minimum isl& kích cỡ. These values can be set explicitly using the command-line mauveAligner application.

Each line of the .backbone tệp tin records a single conserved segment. Left and right end coordinates of the conserved segment are given for each genome sequence. For example, the line:

22256 22371 20147 20299 22255 22370Would indicate that nucleotides 22,256 through 22,371 from the first genome are conserved in the second và third genomes from trăng tròn,145 through 20,299, & 22,255 through 22,370 respectively. Two entries exist per genome, and each entry is tab-delimited. Negative sầu valued coordinates indicate an inverted region (on the opposite strand).

The Progressive sầu Mauve backbone file

Progressive sầu Mauve utilizes a revised backbone tệp tin format which reflects its ability lớn align regions conserved aước ao subsets of the genomes under study. A short example of the backbone tệp tin format is:

An isl& exists in the first genome between <15379-16727>, và its existence is given in the backbone tệp tin as a laông chồng of any line containing that segment. The seq_0_rightover column skips from 15378 on line 1 to 16728 on line two. By mặc định, the rows of the backbone file are sorted on the seq_0_leftend column (absolute value). To infer islands in seq 0, we can thus simply compare the rightover of one line lớn the leftend from the subsequent line. The data can be trivially processed to lớn observe sầu islands in other genomes using a spreadsheet program lượt thích OpenOffice Calc or MS Excel. Simply sort the rows on the absolute value of the column for a sequence (e.g. seq_2_leftend) & then compare right-kết thúc khổng lồ left-end on the subsequent line.

An islvà (or subphối backbone) also exists in the second và third genomes. The existence of the subphối backbone is given on the third line, where seq_0_leftkết thúc và seq_0_rightover both have sầu zero values khổng lồ indicate that the first genome lacks any detectable homology lớn the segments <18447-18668> in the second genome và <18446-18667> in the third genome.

The guide tree file

The guide tree is the standard Newiông chồng tree file format. A decent description of the Newiông chồng tree tệp tin format can be read here: http://evolution.genetics.washington.edu/phylip/newicktree.html

The identity matrix file

This is tab-delimited text where rows and columns are genomes in the order input đầu vào khổng lồ the aligner. Identity scores range between 0 & 1, where 0 indicates that no identical homologous nucleotides were found, & 1 indicates that every homologous nucleotide was identical.

The permutation matrix file

This is a tab-delimited text tệp tin that records the order và orientation that each LCB occurs in the aligned genomes. The permutation matrix file can be used khổng lồ infer phylogenetic rearrangement history using tools such as BADGER, GRAPPA, MGR, và others. This tệp tin is generated by adding the command-line option –permutation-matrix-output= when running mauveAligner. An example of a tệp tin with three genomes and seven LCBs follows:

0 1 2 3 4 5 61 2 3 -6 -5 -4 00 1 2 3 -6 -5 -4 Each genome is recorded on a single line, with lines ordered according lớn the order of input đầu vào genomes. The LCB arrangements are recorded on each line, with the first genome used as a reference genome khổng lồ assign numeric identifiers lớn LCBs. A minus sign (-) indicates that a block is inverted relative sầu lớn the reference genome.

The LCB boundary file

This is another tab-delimited file that complements the permutation matrix file with information about the LCB boundaries. This file can be used, for example, lớn derive the lengths of blocks và by extension, the lengths of genome rearrangements predicted by a rearrangement history reconstruction algorithm. An example of the file format for three genomes follows:

The SNP.. file

This tab-delimited file can be created from alignments using Mauve sầu version 2.3.0 and later. For every polymorphic site in an alignment, the SNP.. tệp tin records the nucleotides present in each genome at that site, along with the sequence coordinates of the site in each genome. An example on three genomes is as follows:

The orthologs file

The orthologs file is a tab-delimited tệp tin that can be created from progressiveMauve alignments using Mauve sầu version 2.3.0 & later. The ortholog file lists groups of annotated & unannotated genes that are predicted lớn be positionally orthologous by whole-genome multiple alignment. Each row in the file lists a group of orthologous genes, along with the index of the genome from which the ren derives, the name of the gen (if given in the annotation file) và its sequence coordinates in the global coordinate system of that genome. Entries within a line are tab-delmited và colon-delimited. An example for 4 genomes follows:

0:Z03:2818-3750 1:c04:3512-4444 2::2801-3733 3:ECSE_03:2800-37320:Z04:3751-5037 1:c05:4445-5731 2::3734-5020 3:ECSE_04:3733-50190:Z05:5251-5547 1:c07:5945-6241 1:c08:6021-6269 2::5234-5530 3:ECSE_05:5233-55290:Z06:5700-6476 1:c10:6301-7077 3:ECSE_06:5682-6458The first line lists a group of four orthologous genes, with one ren coming from each genome. In the first entry 0:Z03:2818-3750, the leading 0 refers khổng lồ the genome’s index, with indices assigned in the order the genomes were input for alignment. Thus genome 0 is the first genome, 1 is the second, và so on. The next part, Z03, refers lớn the locus_tag identifier for the annotated gen. The third colon-delimited part refers khổng lồ the coordinate range of the annotated gen. The remainder of the line lists out genes in the other three genomes found khổng lồ be positionally orthologous. In the case of genome 2 we have sầu an entry 2::2801-3733. In this case there was no gene annotated in the region, but a region was found to lớn be positionally orthologous, and so the coordinates of that region are listed without a locus_tag.

The third line in the example highlights a situation where multiple annotated genes in one genome are found to lớn be orthologous to a single gene in other genomes. In this case, two overlapping genes were annotated in genome 1, và each of those genes individually was predicted khổng lồ be positionally orthologous lớn the corresponding genes in other genomes. Since they overlap & are orthologous lớn the same genes in other genomes, they are considered a group of positional orthologs. Thus, any group of positional orthologs may contain multiple genes from a single genome.

Xem thêm:

The fourth line in the example illustrates the situation where one of the genomes does not have a positional ortholog of the genes. In this case, genome 2 lacks a region predicted lớn be positionally orthologous.